Login · Supported browsers · Citing the BCBC · Contact · Version 4.11
. .
 

RNAi.Rat.ME2.HI RNA - Adenovirus RES366


RNAi Adenovirus Information

NCBI Gene Name malic enzyme 2, NAD(+)-dependent, mitochondrial
NCBI Gene Symbol ME2
NCBI Gene ID 307270
Species Rat
Nucleotide Accession Number XM_225729
Promoter HI RNA
Target Position 848 nt
Target Sequence GACGACATTCAAGGGACTGC
Comments approximately 60% knockdown

Repositories

Newgard Lab
Out of stock Stock #: Not provided
Availability Notes: Not provided

Contact Information

Preferred Contact
Name Michelle Arlotto
Institution Not provided
Phone 919-479-2319
Email arlot001@mc.duke.edu

Associated Publications

No publications associated

Comments

There are no comments for this entry.

Login to add comments

Access Status

Public access This resource is publicly viewable.

Request this Resource


Resource Tags

adenovirus, ME2, Rat, RNAi

Read the Tags tutorial Read more about tags

Resource History & Actions

Approved on Sep 27, 2006
Last modified on Sep 27, 2006
Login to edit or request an edit

Related resources

Loading...