Polyclonal Human HNF6 raised in Rabbit - Antibody RES311
Antibody Information
| Antibody ID: | AB2025 |
|---|---|
| Antigen: | HNF6 (NCBI Gene ID: 3175) |
| Type: | Polyclonal |
| Isotype: | Not Applicable |
| Immunogen Source: | Peptide |
| Raised In: | Rabbit |
| Peptide: | AA 10-110 at N-terminus in human |
| Source of Antigen: | Human |
| Cross Reacts With: | Mouse,Human |
| Affinity Purified: | Affinity Purified |
| Purity Details: | Not provided |
| Positive Control: | HepG2 cell line |
| Notes: | Works very well for ChIP, Western |
Applications and Uses
| Application | Concentration | Storage Buffer | Protocols and Description |
|---|---|---|---|
| ChIP | 10 ug / rxn | as provided |
Description: Not provided Protocols: |
Associated Images
| No associated images have been supplied | |
Repositories
| Santa Cruz Biotechnology | |
|---|---|
 Request via www.scbt.com website
|
Stock #: sc-13050 Availability Notes: Santa Cruz |
Contact Information
| Not provided |
Associated Publications
| Publication | Citation |
|---|---|
| 14988562 | Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ, Murray HL, Volkert TL, Schreiber J, Rolfe PA, Gifford DK, Fraenkel E, Bell GI, Young RA Control of pancreas and liver gene expression by HNF transcription factors. (2004) Science 303: 1378-81 (Added April 19, 2011) |
Comments
09/26/2012 09:57 AMOle Madsen |
Chromatin immunoprecipitation (ChIP) assay Neural tubes were dissected from HH17-18 chick embryos. Cells were homogenized in DMEM/F12 using a Dounce homogenizer and treated with 1% formaldehyde at room temperature for 10 minutes. Immunoprecipitation was performed using a ChIP kit (Millipore #17-371) according to the manufacturer’s instructions. Chromatin was fragmented to 200-1000 bp by sonication (high power, 30 cycles of 30 seconds with 1 minute between pulses) and incubated overnight at 4°C with antibody against Hnf6 (Santa Cruz #sc-13050) at 1:50 or species-matched IgG. Primers (5′-3′) were: TTGCTGAATGCTGAAAGCAC and TTCTTTGCACAGCCAGTTTG for CREST1; AGCTAAAGCCCACATTTTGC and CAACAGTTCCTGCATTAGCA for CREST2; TGTATGGCAGCCACAAGAGA and TCCCAAGAAGCAGGCATAAT for CREST3; CTTGCGATGCTTTTTGTGAC and CGTGGAGCAGTTTTACAGAC for noggin. Fold enrichment was calculated over IgG using 2(–ΔΔCT), where ΔΔCT=(Ctip–CtInput)–(CtIgG–CtInput). Ref: PMID: 22833130 Development. 2012 Sep;139(17):3109-19. |
Login to add comments
Access Status
This resource is publicly viewable.
Request this Resource
Resource Tags
Resource History & Actions
Related resources
Loading...
